SGN Marker T1666

SGN-M2175
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD03TH
Arabidopsis best BAC match: AC006300.3
Arabidopsis position: 2.1440000
Arabidopsis identities: 0.673
Best GenBank protein hit: AAD20712.1
Evalue: 5.3e-50
Identities: 0.568
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39732)
Chromosome
6
Position
43.70 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1666 was used as an overgo probe on plate 1 [well H11]

Plausible BAC Matches:   P010E05,   P158G07,   P175D01,   P315I14,   P277A08,   P073A19,   P222N07,   P094C23,   P170D02,   P083I04,   P038H01,   P055G03,   P176G01,   P218O09,   P154L15,   P282A22,   P086D02,   P246K17,   P033M17,   P258P01,   P233H10,   P265K19

 Overgo Sequences

A sequence
TGTCTCGGAAACCTGAAGATGTGG
B sequence
TTCCCGACTCCTTCTTCCACATCT
AB sequence
TGTCTCGGAAACCTGAAGATGTGGAAGAAG
Marker sequence
GGGGTTGTGAAATGAGAAAACTTTCTGTTTTTCTTTCTATCGGATTCGCT
CATAGATCCTCTAAATTCCGCAGCAGCAATAATCATCATAACGCTCTTCG
TTTTTACAGCAATATTTCCCCTTCTCCCTCCAAGAATCATGGACTTCTTG
CACATTACAGGAGTCTTGTTGAACAGGGAAAGCTGCAGCATGATCCTTAC
CAAGAAAAAGTTGCTACTGAACTAGAAAATCTTCTTGGAAGGTTGGAGCA
ATATGAAAAGGACATGGAGGAATATCATGAAAAACTTGCACAATGGGAGG
ATAATAGGGAAAGTCGGAGGCGTAAGCTTCTTATGGAGGAAGCTGAGGCC
AAACAACAAGGTGCATTTAAACCAATAAACAAATCTCGCAATATTTTCCA
AAGATGGATGTCTCGGAAACCTGAAGATGTGGAAGAAGGAGTCGGGAAAT
GGGTTTCATATCTCAATCGAGAGAAGAAGTTAGATTCACAAGTCGGTCGA
CGTCCTGCTGCTCCTCCAGCCCCCAAAGGACTATATCTATATGGCAATGT
TGGGAGTGGGAAGACAATGATTATGGATATGTTTTATAAAGCCAGTGAA
Genomic location of T1666  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2175 marker 2175
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)