SGN Marker T1667

SGN-M2176
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD06TH
Arabidopsis best BAC match: AB025606.1
Arabidopsis position: 5.2060000
Arabidopsis identities: 0.813
Best GenBank protein hit: BAA98077.1
Evalue: 1.9e-91
Identities: 0.814
Description: contains similarity to GTPase activating protein~gene_id:F6N7.7 [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39733)
Chromosome
12
Position
39.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1667 was used as an overgo probe on plate 4 [well C5]

Plausible BAC Matches:   P244C09,   P120O09,   P146I19

 Overgo Sequences

A sequence
GAGGCCTCATTGAAAAAGATGTGG
B sequence
GACCTATCAGTCCTCACCACATCT
AB sequence
GAGGCCTCATTGAAAAAGATGTGGTGAGGA
Marker sequence
GAATTTCTGTTGGGATACCATTCATATGATTCAACTTATGCAGAGAGGGA
ATACCTTGTGTCCGTCAAAAAGTCAGAATATGAAACGATAAAAAACCAAT
GGAAGAGCATCTCTAAGGAGCAGGCAAAAAGATTTACAAAATTCCGAGAG
AGGAGAGGCCTCATTGAAAAAGATGTGGTGAGGACTGATAGGTCAGTTTC
ATTCTATGAAGAGGATGACAACCCAAACATTAAATGTTTGCGTGATATAC
TGCTGACATACTCATTCTACAACTTTGATTTGGGTTACTGTCAGGGTATG
AGCGATCTCCTTTCACCAATATTGTTTATTATGGGAGATGAATCAGAAAC
ATTTTGGTGCTTTGTGGCGTTGATGGAACGACTTGGACCAAACTTTAACC
GTGACCAAAATGGAATGCACTCTCAGCTTTTTGCATTATCAAAGTTGGTC
GAGTTGTTGGACATCCCTCTGCATAATTACTTCAAACAGAAGGACTGTTT
GAATTATTTCTTCTGCTTCCGATGGGTTCTTATTCAATTCAAAAGGGAGT
TTGAATTTGAACAAACGATGCG
Genomic location of T1667  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2176 marker 2176
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)