SGN Marker T1670

SGN-M2179
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD12TH
Arabidopsis best BAC match: AC015985.8
Arabidopsis position: 3.0132000
Arabidopsis identities: 0.707
Best GenBank protein hit: AAF23250.1
Evalue: 5.8e-23
Identities: 0.750
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39736)
Chromosome
9
Position
13.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1670 was used as an overgo probe on plate 1 [well G3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
ATATGGATCGGGTCTGCTGCTTTC
B sequence
TCCATGTCAGTGCAGAGAAAGCAG
AB sequence
ATATGGATCGGGTCTGCTGCTTTCTCTGCA
Marker sequence
GAGAAGAAGAAGCAGAAAATGGAGAAGTACTTTGGAAACGCATACAGGGG
TGACCCGGGAGTGCCACATGCCGACCCGGAACGGTTCGTGAATATATGGA
TCGGGTCTGCTGCTTTCTCTGCACTGACATGGATCAATCCCTACATGTGG
ACTCTTTCCAATCAATACAACTGGCATGACAAAGCCATGCTTTTTGAGCA
ATATCACTGGAAGAAAGCTCTCAAGAAAAATCAGGACTATGAATTCAAGT
GGAACCAATACATGGATAAAGATACCCGAGACTCGTACTACTTCAATTGG
CCTGTTTACTTTCCATAAGTTTCTCCAATTTATCAGCATGCTTCTGTTTC
CTTTTGAAATTTCTGTTGATACTATGAATCAAAACATTTTTAGCCTCTGA
AAAGTTTGGTGATATTCCAAGTGCTGCATGATTGCTTTTTCT
Genomic location of T1670  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2179 marker 2179
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)