SGN Marker TG565

SGN-M218

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1700
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
Forward sequence
ACTAGCATCTCTTGGAGGATGCTGAGGTGTCAAGTGGTGTTGACCACTCGTTACCACTGATTCACAGCTGGTGTCTTTCGAAGCAAGCTT
CGTCTGCAAAACAAGAATCACACTTTAATCCTCTGTTACCTAAAAACAATAGTTGTTTGATGTAATGAAAGAAGAATTTTCACTTCAATG
ATGGAAAGAAAATCTTACAGTTTGAGTTTGCTTGCGAAAGTAGCCATTTTCATACACCAGTTGAGAAACTTGCTTCTGCAATCTATCATT
CTCTTCCATTAATAGCTTGTTCATTGCTGACAGCTTCCTATTCACACCCTGAAGCCTTGATGACTCTTTCCTCTGTTTTTCCCTACATCT
ATACAACTCAAAGAAACAATCAATTATACTTCAAATTAATTGGGGTCGCTAAAAATGAATCCTTTAGACTAACAACATCCCACAAGTCCT
TACCCCTACCTCGCAGAGGTAGAGA
Reverse sequence
TCAGCAAAATGTCACACAGAGAGTACAGTAGTAGAGCACAGTAGAGTAGGGAGAAGTTGCCTCAAAAGAGGAAAAGAAAAGGTAACGAAC
CACACATTTGACAGCTCAAAACCACTTTACCAATCCAAACAAAAAATCATCACATTATCCCTCCCTTCTCTCCTTTCTCTATTACTCTCA
TTTTCCCCAAGTTTCAGGTACCTTTTTCCTAACATAATCCGCCCATAGTGTTCATCATTCAAGATCTGTCCTTTTGAGGAGACTTCATTC
CTTACTATGGTCTTCTTTTTTTGATGATTTCTTATGTGAGATGTTGAAAACTGGAAAGAAGTGATAAAGATAGGAGGTTTGGTTTCTGGG
GTTTGTTTATTTTGCTTTACAAGGGTTAAAGATTGGATCTTTTTTAGTTTTGGTAGATACCCATGTCTAATCTTGTTTCAGAATTCAAAA
GGTTGGTACTTTACTGTTTTGCAAGTGGATGACAGAGGAG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U1680445.8e-1397 (20.4% of RFLP seq)+
SGN-U1727492.2e-80162 (34.1% of RFLP seq)+
SGN-U1727497.3e-65160 (32.7% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53569)
Chromosome
12
Position
35.30 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Sun1642 x LA1589   
Map version
85 (location: 43880)
Chromosome
12
Position
44.80 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43619)
Chromosome
12
Position
51.30 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43342)
Chromosome
12
Position
47.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42489)
Chromosome
5
Position
62.20 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40885)
Chromosome
12
Position
48.00 cM
Confidence
uncalculated
Protocol
SSR


Tomato-EXPIMP 2008

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40089)
Chromosome
12
Position
57.60 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8628)
Chromosome
5
Position
62.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8627)
Chromosome
12
Position
46.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8632)
Chromosome
12
Position
52.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG565 was used as an overgo probe on plate 14 [well A3]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGCATCTCTTGGAGGATGCTGAG
B sequence
CAACACCACTTGACACCTCAGCAT
AB sequence
TAGCATCTCTTGGAGGATGCTGAGGTGTCA
Marker sequence
ACTAGCATCTCTTGGAGGATGCTGAGGTGTCAAGTGGTGTTGACCACTCG
TTACCACTGATTCACAGCTGGTGTCTTTCGAAGCAAGCTTCGTCTGCAAA
ACAAGAATCACACTTTAATCCTCTGTTACCTAAAAACAATAGTTGTTTGA
TGTAATGAAAGAAGAATTTTCACTTCAATGATGGAAAGAAAATCTTACAG
TTTGAGTTTGCTTGCGAAAGTAGCCATTTTCATACACCAGTTGAGAAACT
TGCTTCTGCAATCTATCATTCTCTTCCATTAATAGCTTGTTCATTGCTGA
CAGCTTCCTATTCACACCCTGAAGCCTTGATGACTCTTTCCTCTGTTTTT
CCCTACATCTATACAACTCAAAGAAACAATCAATTATACTTCAAATTAAT
TGGGGTCGCTAAAAATGAATCCTTTAGACTAACAACATCCCACAAGTCCT
TACCCCTACCTCGCAGAGGTAGAGA
Genomic location of TG565  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D218 marker 218
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)