SGN Marker T1673

SGN-M2181
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD24TH
Arabidopsis best BAC match: AC010927.3
Arabidopsis position: 3.0135000
Arabidopsis identities: 0.628
Best GenBank protein hit: AAA87047.1
Evalue: 3.1e-07
Identities: 0.319
Description: pistil extensin-like protein [Nicotiana alata]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49482)
Chromosome
9
Position
2.06 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47416)
Chromosome
9
Position
26.78 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-LXCHM 2007   
Map version
68 (location: 43012)
Chromosome
9
Position
6.30 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44012
Forward primer (5'-3')
GAAGCCTCAGATGGAATGGATG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
ATCATCAACTCATCCACCATAGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39738)
Chromosome
9
Position
27.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1673 was used as an overgo probe on plate 14 [well H9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCAAAGCCATCAAAGGTAGCATCG
B sequence
AGGCACGTCAGAGATACGATGCTA
AB sequence
CCAAAGCCATCAAAGGTAGCATCGTATCTC
Marker sequence
TTTGAACAAATATTATTTAGAGAAATAAAGTGAGAATTATGAAAATGAAT
ATAGTTTTTATAGCCTCATTAATTTTGGTGTTTTCTAATTTTATTGAAGC
CTCAGATGGAATGGATGTTATGCATATTTCTGGCAAAGTTCTTTGCCAAG
ATTGTACTCAAGGATGGAATGAATGGGTTGATGGTGCCAAAGCCATCAAA
GGTAGCATCGTATCTCTGACGTGCCTGGACGAGAGAAGAAGAGTGATGTA
TTACGGAAGTGACCTCACAGATGAAGCTGGAATTTTCGATTTGATTGTTA
ACCAAACTTGTCATGGCAAAACAATTAAGCCACAAAATTGCTTTGTGAGA
TTGGTTTCTTCACCTGATCCTGTTTGTAATATTGCCACCGACTTCGCCGG
AGGAAAATCCGGTGTAAAGCTCCACCGTCCGACGGTGGTTTACCGGGACT
TGCTCAAATATGTGCTTAGCCCTTTCTACTACACAACTCCCATGTGTGAT
GAACCTAATATTAATGATGATGATAATTTGGAGACTAATGATGATAAAAA
TCAAAACAATTATTAAATTAAGTTCTTATTTTTAATTTTTTCTTCTTCTA
ATGTTTGGGTTTAATTTCCCATTTTGTAAATGGAAAATGACAATTTATCT
ATGGTGGATGAGTTGATGATTTTATTTTG
Genomic location of T1673  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2181 marker 2181
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)