SGN Marker T1675

SGN-M2182
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 10.01.01.99
Tomato EST read: TRZBD37TH
Arabidopsis best BAC match: AC012563.5
Arabidopsis position: 1.1331000
Arabidopsis identities: 0.822
Best GenBank protein hit: AAF16557.1
Evalue: 2.6e-71
Identities: 0.754
Description: unknown protein; 35653-33693 [Arabidopsis thaliana]
Comment: similar match with gb|AAF32298.2|AF216523_1 (AF216523) FKF1 [Arabidopsis thaliana]
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39739)
Chromosome
1
Position
3.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1675 was used as an overgo probe on plate 1 [well G7]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GAGAAACTTGCCAGTCTCACTGTG
B sequence
TATTCGCTGGACTCGTCACAGTGA
AB sequence
GAGAAACTTGCCAGTCTCACTGTGACGAGT
Marker sequence
GAATATTTAAGCATCCATCTCATGATATACTATATGTTGACATCATTTAC
TGTTGAGGAATCTTGACACGTTCACTGAATTATTTTCAGTCGGTTTTTGC
AATTTAGAGATCCACGCGCTCAAAGGCGGCATCCTTTGGTGGATCCTGTT
GTTGTTTCTGAGATCAGAAGATGTCTTGAAGAAGGTGTTGATTTCCAAGG
GGAGCTTCTCAACTTTAAAAAAGATGGTACACCTGTGGTGAATAGGCTAA
GACTTGCACCCATACATAGTGATGATGGCACAGTGACCCATATTATAGGG
ATTCAAATGTTTTCTGAAACAAAAATTGACCTGAATACTGTGTCATATCC
CGTTTTCAGAGAAACTTGCCAGTCTCACTGTGACGAGTCCAGCGAATACT
CCATTAAAAGCGGTAATTTATTGCATTGTCAGCACCGTGAAATATGCGGT
ATTCTTCAGCTCTCTGATGAAGTTCTAGCTCACAACATTTTATCTCGATT
GACTCCAAGGGATGTTGCATCCATTGGTTCTGTTTGTAGAAGGATACGCC
AATTGACGAAAAATGAGCATGTGAAAAAAATGGTCTGTCAAAATGCATGG
GGAGCTGATGTCAC
Genomic location of T1675  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2182 marker 2182
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)