SGN Marker T1676

SGN-M2183
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD54TH
Arabidopsis best BAC match: AC027665.4
Arabidopsis position: 1.0446600
Arabidopsis identities: 0.754
Best GenBank protein hit: AAF79611.1
Evalue: 3.0e-49
Identities: 0.694
Description: putative 4-coumarate:CoA ligase [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39740)
Chromosome
12
Position
86.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1676 was used as an overgo probe on plate 4 [well G9]

Plausible BAC Matches:   P004B08,   P113D24,   P065O02,   P113A06,   P113I09,   P123B11,   P115G22,   P101D12

 Overgo Sequences

A sequence
AACGACGTAGCTACTCTGCTTTAC
B sequence
CGGTAGTACCAGATGAGTAAAGCA
AB sequence
AACGACGTAGCTACTCTGCTTTACTCATCT
Marker sequence
GGAAACTCACCGGATTTAATCTCCCGGTGATTTTAATCGACGGAGTGAAT
GATTCAAATTCGAATCTCAAAATCGTTGGGGATTTACAGAAATTGATTCA
GAGAAAACCTAGTGAAAGCAGATTGAAAGAGAGAGTTACACAAAACGACG
TAGCTACTCTGCTTTACTCATCTGGTACTACCGGAGCAAGCAAAGGAGTT
ATTTCATCTCACAAAAACCTAATCGCCATGGTTCAAACTATAGTCAGTCG
ATTCAATCTAGATGAAGGTGTACAAACCTTCATTTGTACTGTACCTATGT
TTCATATTTACGGATTAGCAGCGTTTGCAGCTGGGTTATTAGCATCTGGA
TCTACTGTTGTTGTATTATCAAAATTCGAAATGGATGAAATGCTCTCATC
GATTCACAAATACAAAGCAACTTCTCTACCATTAGTGCCTCCAATTCTCG
TTGCGCTTGTGAATAACGCTGATTGGATTAAGAAAAAATATGATTTAAGC
AGCTTGGAGAGTGTTCTCTCCGGCGGTGCTCCGTTGAGTAAGGAAGTGAT
TGAGGGATTTGTA
Genomic location of T1676  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2183 marker 2183
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)