SGN Marker T1680

SGN-M2186
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 5.01
Tomato EST read: TRZBD70TH
Arabidopsis best BAC match: AC002332.2
Arabidopsis position: 2.1870000
Arabidopsis identities: 0.829
Best GenBank protein hit: AAB70426.1
Evalue: 5.7e-40
Identities: 0.975
Description: Strong similarity to 60S ribosomal protein L17 (gb|X01694).[Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39743)
Chromosome
9
Position
56.50 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1680 was used as an overgo probe on plate 7 [well E5]

Plausible BAC Matches:   P178O02,   P184G14

 Non-Plausible BAC matches

P222K05,   P299P05,   P253G13

 Overgo Sequences

A sequence
TGAAGAAGGGTAAGCCCGATCTCA
B sequence
GGCATGACTTTCTTCCTGAGATCG
AB sequence
TGAAGAAGGGTAAGCCCGATCTCAGGAAGA
Marker sequence
GGTCATGGCTATCGTGAAGAAGGGTAAGCCCGATCTCAGGAAGAAAGTCA
TGCCTGCCGTCATTGTTCGTCAGCGCAAGCCATGGCGCCGAAAGGACGGT
GTCTTCATGTACTTTGAAGATAATGCTGGTGTAATTGTGAACCCCAAGGG
AGAAATGAAAGGATCTGCAATTACAGGGCCAATTGGGAAAGAGTGTGCTG
ATCTTTGGCCAAGAATTGCAAGTGCTGCTAATGCTATTGTGTAGAAGAGT
TCCCTTGAGTAGTTTGAAATTCTTGTTTTTAACAGTTAAATTTATGTTTT
TGGATATCAGATTGTTTTCTTATTAAGAGATCAGTTTTTGCCGGTTTG
Genomic location of T1680  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2186 marker 2186
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)