SGN Marker T1681

SGN-M2187
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBD79TH
Arabidopsis best BAC match: AL021961.2
Arabidopsis position: 4.1740000
Arabidopsis identities: 0.710
Best GenBank protein hit: CAB80132.1
Evalue: 6.8e-37
Identities: 0.500
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49484)
Chromosome
10
Position
43.16 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47418)
Chromosome
10
Position
31.71 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39744)
Chromosome
10
Position
34.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1681 was used as an overgo probe on plate 1 [well B9]

Plausible BAC Matches:   P306E10,   P322A24,   P251A16,   P046O15,   P104G23,   P257K17,   P297D24,   P057K22,   P220L05,   P257I17

 Overgo Sequences

A sequence
CCGTACTCGTACATGTACAGATGG
B sequence
CGTAGGGTTTTTACCGCCATCTGT
AB sequence
CCGTACTCGTACATGTACAGATGGCGGTAA
Marker sequence
GGTCATCGTTGTCTTCTTTCTTCTTCTACTTTCCATGTCGATAGCATATG
GCATCCAAGGCCAACTCCTTGAAGTAACTGTTGTTGCTTGTAATAAACTG
AAGGATACTGAATGGATTTCAAGGCAAGATCCGTATGTTTGCCTTGAATA
CGGAAGTTCTAAATTCCGTACTCGTACATGTACAGATGGCGGTAAAAACC
CTACGTTTCAAGAGAAATTTGTGTTTAAGCTAATTGAAGGGTTGCGAGAG
ATCAATGTTGTTGTGTGGAATAGCAATACTGTTAATTCAGATGATTTTAT
AGGGAGTGGAAAGGTTCAACTACAGAAGGTTCTCTCACAGGGATTTGATG
ATACTGCTTGGCCACTTCAGAGGAAGAACGGCAGGCATGCAGGAGAAGTT
CGACTAATAATGCACTATGCAAATACCAATAAGCCAGCAACAAGCCATGC
TCAATCAGGCCCTCCATTTGTTACACCAACTCCTGGATCATATCCATATT
CAGTAGCTCCACCACATGTAGCTTCTCACCCAACACCTTCTGGCTATCCA
GCACCATCTCCTTATTCCACAGCCTCGCCTCCTTCAGCATTTTATCCAGC
TTCTCCTTATTCCACAGTCCCACCACCTCCAGCAGCATATCATTCAACAT
CTCTTTATCCCCCCTAATCGGCTGCTTATCCTTCACCTTACTCAT
Genomic location of T1681  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2187 marker 2187
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)