SGN Marker T1682

SGN-M2188
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBF06TH
Arabidopsis best BAC match: AC006921.5
Arabidopsis position: 2.1990000
Arabidopsis identities: 0.784
Best GenBank protein hit: AAD21434.1
Evalue: 7.4e-43
Identities: 0.546
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-LXCHM 2007   
Map version
68 (location: 43013)
Chromosome
10
Position
25.50 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-LXCHM 2007

PCR data   Exp. ID 44013
Forward primer (5'-3')
AATAAACTGAAGGatACTGAATGG
Accessions and product sizes
Approximate temperature
58°C
Reverse primer (5'-3')
TAAGGTGAAGGATAAGCAGCCGA
Digested band sizes (using unknown enzyme)
Mg+2 concentration
Unknown
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39745)
Chromosome
10
Position
66.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35610
Forward primer (5'-3')
CCTCCCTCACCATCCAATTA
Digested band sizes (using EcoRV)
Solanum lycopersicum LA925: 314+490
Solanum pennellii LA716: 804
Mg+2 concentration
3mM
Reverse primer (5'-3')
CTGCTTTAACCACCGGATTC
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 804
Solanum lycopersicum LA925: 804
Approximate temperature
55°C
  
PCR data   Exp. ID 132
Forward primer (5'-3')
Unknown
Digested band sizes (using EcoRV)
Solanum pennellii LA716: 804
Solanum lycopersicum LA925: 314+490
Mg+2 concentration
3mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 804
Solanum pennellii LA716: 804
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1682 was used as an overgo probe on plate 15 [well G4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TCGGAAGAGAAGCCATTGCTAAGG
B sequence
TTAACCACCGGATTCGCCTTAGCA
AB sequence
TCGGAAGAGAAGCCATTGCTAAGGCGAATC
Marker sequence
GATATCGAAGAGAAATCGATATAATTATGGCGGAAGAACATGGATTTGAA
GCACCAGAAGGACATATATTATGCGCTAATAACTGTGGTTTCTTTGGTAG
CCCAACAACGCAAAATTTCTGCTCCAAATGTTACAATGAAGTTTACATAA
AAGGGGGACAACAAAAACCTATTGATTCCCTTTTTCCTCCTTCGCAGCTG
CCGATTCCATCAACCTCATCGATACTGGTGCTGCAGGAATCGACAGCTGC
GGAGGAAGAACCTGAGGTTGTGACCGCTGTAACAGTCGCGGTCCAACCGA
TTTCTGCACAGCCGAACAGATGTTCGGCCTGCAGGAAGAAGGTGGGATTG
ACAGGGTTCAAGTGCAGATGTGGGACCACGTTTTGTGGGACCCATCGGTA
CCCGGAGATCCATGGATGCTCGTTTGATTTCAAATCTATCGGAAGAGAAG
CCATTGCTAAGGCGAATCCGGTGGTTAAAGCAGAGAAATTGGGGAAGATA
TAATCACAGCCGTTGAATTTAGATGATGAAATCTCGTCGGAAAATGACGT
CATGTGAATTAAATATTACTG
Genomic location of T1682  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2188 marker 2188
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)