SGN Marker T1683

SGN-M2189
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.06.1.07.1
Tomato EST read: TRZBF08TH
Arabidopsis best BAC match: AB025631.1
Arabidopsis position: 3.0560000
Arabidopsis identities: 0.885
Best GenBank protein hit: BAA13096.1
Evalue: 3e-114
Identities: 0.876
Description: diminuto [Pisum sativum]
Comment: brassinosteroid biosynthesis
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39746)
Chromosome
2
Position
2.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1683 was used as an overgo probe on plate 11 [well C1]

Plausible BAC Matches:   P257J09,   P269L19,   P162L03,   P077L14

 Overgo Sequences

A sequence
CCATGGTGTATACTCCCACAGAAG
B sequence
CCAGTCATGCAAACAGCTTCTGTG
AB sequence
CCATGGTGTATACTCCCACAGAAGCTGTTT
Marker sequence
GGAATACATGAAACTTACCTACAAACCTGTAGTTGGTAATTTGAAAGAGA
TTGCTCAGGCTTATATGGATTCTTTTTCACCTAGAGACGGGGATCAGGAT
AACCATGAGAAAGTTCCAGACTTTGTTGAAACCATGGTGTATACTCCCAC
AGAAGCTGTTTGCATGACTGGTAGATATGCTTCAAAAGAAGAGGCCAAGA
AGAAGGGCAATGTGATCAACAATGTTGGTTGGTGGTTCAAAACCTGGTTT
TACCAGCACGCTCAAACTGCACTCAAGAAGGGAGAATTCGTAGAGTACAT
CCCAACTAGGGAATACTACCACAGGCACACAAGATGCTTGTATTGGGAAG
GGAAACTTATCCTTCCATTTGGTGATCAATGGTGGTTTAGGTTTCTCTTT
GGATGGGCCATGCCTCCCAAGGTTTCTCTACTTAAAGCCACTCAAGGTGA
ATACATTAGGAACTATTACCATGAAAACCATGTCATTCAGGATATGCTTG
TTCCTCTCTACAAGGTTGGTGATGCTCTTGAGTGGGTCCACCGTGAGATG
GAGGTGTATCCCCTCTGGCTCTGCCCCCACAGACTCTACAGGCTGCCTCT
TAAAACAATGGTGTATCCTGAACCAGGTTTTGAGCT
Genomic location of T1683  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2189 marker 2189
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)