SGN Marker T1685

SGN-M2191
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBF14TH
Arabidopsis best BAC match: AC004122.1
Arabidopsis position: 1.0280000
Arabidopsis identities: 0.785
Best GenBank protein hit: AAC34343.1
Evalue: 3.1e-34
Identities: 0.821
Description: Unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39748)
Chromosome
4
Position
92.00 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1685 was used as an overgo probe on plate 7 [well B8]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTTGCATCGGTATGGTTTGGCTTC
B sequence
GAGCCCAAATATCGACGAAGCCAA
AB sequence
CTTGCATCGGTATGGTTTGGCTTCGTCGAT
Marker sequence
TTAAAGAGATGGAGCTGTTAGGATGGTGGTTAATGCTAGTGGGTACCACT
TCGGCTTGCATCGGTATGGTTTGGCTTCGTCGATATTTGGGCTCTTCGTC
TCGCTGTTTTCTCCAAAACTACCATGACAGAAGTTCATGGGAGGACATTT
GGAGTGTGGACTCTCCTAACCTGCACTCTTTGCTATCTCTGTGCATTTAA
CCTTCATGACAGACCTTTGTATTTGGCAACCATTTTATCATTTGTCTATG
CCTTCGGTCATTTCTTGACAGAGTTCTTGATCTATCAGACAATGGAAATA
AAAAATTTGGTTACTGTCGGTATATTTGCAGGCACATCTATCGTTTGGAT
GTTGTTGCAGTGGAATGCACACCAACAGGTCAAAACTAAGAGTCCATAGA
CCCGAATCAACAGCAGTGGCTTGAAGCAGATTTTATCGGGTGTTACTCCT
CTCAACCTATGCCTTTGCTGCTGCAATTTTAGGCCTTCGAGTTTTAGTGT
GTAAACATTGGTTTCATGGTTGAGTTCTGAAAGAAACTTCTTGGCCACAA
TTTCTTATTCTAATGACTCAATGCCAG
Genomic location of T1685  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2191 marker 2191
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)