SGN Marker solcap_snp_sl_31712

SGN-M21955

Synonyms  
SGN-U567706_snp723
SGN-U567706_snp723_solcap_snp_sl_31712
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70394)
Chromosome
6
Position
65.40 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 66923)
Chromosome
6
Position
81.06 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63405)
Chromosome
6
Position
98.42 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58286)
Chromosome
6
Position
44.78 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGGAGTTTCAGAATTATTTGCAATGCAATGTTAAATACCTGTTATCAGCC
  
3' flanking region
TCATCAATCCTGAATAACTACTACGTATTTAACCTGTTGAAAAAACTCTA
SNP nucleotide
AG
SNPdb format
AGGAGTTTCAGAATTATTTGCAATGCAATGTTAAATACCTGTTATCAGCC[A/G]
TCATCAATCCTGAATAACTACTACGTATTTAACCTGTTGAAAAAACTCTA
  
Genomic location of solcap_snp_sl_31712  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21955 marker 21955
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)