SGN Marker solcap_snp_sl_31775

SGN-M21973

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64770)
Chromosome
1
Position
182.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58304)
Chromosome
1
Position
86.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GCATCCATATAGGTGTAGCTACGAGAGCCATCGGGGGCGCGATAGCAATC
  
3' flanking region
GCAAGGAGGATAGAAGCAAACCATGTTATGGCTGAGAAAGCAATGAGTGC
SNP nucleotide
AG
SNPdb format
GCATCCATATAGGTGTAGCTACGAGAGCCATCGGGGGCGCGATAGCAATC[A/G]
GCAAGGAGGATAGAAGCAAACCATGTTATGGCTGAGAAAGCAATGAGTGC
  
Genomic location of solcap_snp_sl_31775  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21973 marker 21973
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)