SGN Marker solcap_snp_sl_31924

SGN-M21990

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72196)
Chromosome
7
Position
64.23 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68390)
Chromosome
7
Position
45.97 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58321)
Chromosome
7
Position
61.32 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAGAAGCGTGCCACTGCATTCGGTCTCATGAAGATTGATGAAGAAGGACG
  
3' flanking region
ATTATTGAATTTGCAGAGAAACCGCAAGGAGAGCAATTGCAAGCAATGAA
SNP nucleotide
TC
SNPdb format
GAGAAGCGTGCCACTGCATTCGGTCTCATGAAGATTGATGAAGAAGGACG[T/C]
ATTATTGAATTTGCAGAGAAACCGCAAGGAGAGCAATTGCAAGCAATGAA
  
Genomic location of solcap_snp_sl_31924  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D21990 marker 21990
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)