SGN Marker TG403

SGN-M22

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1800
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG403 image not available
Forward sequence
CCCGCCAAATTGTCACTCCATGGGAATCTCCATATTTAAGGACTCCATTTGAAAAACACAACCACTAAGACATCACTTTACCTTAGATGA
TTGCTCTGTACATTAAGGTATAGCACCCTATTCTTTAGTCCTAGTTTCCCAACCTTTCAACCATAAAGCAAATACCAAATTGTCAAAACT
GGCTCTTAGCATAGATAGGAGGCTCAACTATTCCAGAATAGAACAATCCTGACAAATTCTTATACAGTGAAGTACATTACAACTCCACGT
TGAAAGACAGAGGGTTGAAGGTACACCAGCCATTTGATAAGGTTTTTCGTCTAGAAATTAGAGTGAATAGAAATGAGAACAGTAGCTAGA
TCACTAAGTACTAATCGTACTTCAGCATAATAAGTTTCTGTCAAAATAACTCTGTTACGCCACAAAAGAGTCGCATAATCTTCCAGCTGA
AAGTTTATGGAATAGAAAAAATAAGAAGTCAAGACACACTATTTGCCTTGGTTCCCTTATGCAGCTTTGGAACTTCTCTTTTCTTTTGGG
GGATGGAGAAAGTGAGATGTCAGTGTC
Reverse sequence
TAACCCTTGGCCAACGACCTCCGCCGCCGGGAAATATTTACATCTCCGGCTACCGACGGATTTGTATAACGTATTTAATCTTCATTATAC
ATCCGAACGTAGGAAATGGAGGTTCTTCGGTTTACCGCCGTGAAATCATTGAGTTCATGCGTCCGTCCAGAATTCACGGCGATGAGTTCC
GTCATTGTTCCTATTAGCACTGTGAAAGTTTCTGGAACGAGGAAAAGCAAAAAGAAGGCGTTTATTTGTGCTAAGGCGACGGAGATCTTG
TCATCGCCAGCTACGGTAACGGAACCGTTGAAGGCGGAGCCGGCAGAGGCACCGGTTCCGTTGCTACGAGTTTCTCCGAGCTCGTTGCAG
TGTGAGCCGGGATATTTGTTACCGAATAGTCCGGTTTTAGGTACGGGTGGTGTGACCGGGTATGAGTATCTGACGAACATCTTGTCATCG
AAAGTTTATGATGTAGCTTATGAGACGCCTTTGCAGAAAGCTCCTAAGCTGTCAGAAAGATTGGGAGTTAATGTATGGCTAAAAAGAGAG
GATCTTCAGCCGGTATGTATTTTTTTTATTGGTTTTGTTCTTTGCAATATTGCATAAGTTGTTAAAAGTTCGAATATTTGGTGTTAAGTG
AAGTTCTTTTTCTGTTTCTCTGATGGATTTCCT
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U146554554 (83.6% of RFLP seq)-
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53550)
Chromosome
10
Position
69.88 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53299)
Chromosome
10
Position
67.90 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_10 MQTL_2_Late_blight_10
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43866)
Chromosome
10
Position
81.50 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43609)
Chromosome
10
Position
75.70 cM
Confidence
uncalculated
Protocol
RFLP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43328)
Chromosome
10
Position
69.30 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40031)
Chromosome
10
Position
71.30 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000

Map: Tomato-EXPEN 1992   
Map version
28 (location: 7774)
Chromosome
10
Position
67.60 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 7778)
Chromosome
10
Position
32.80 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 7777)
Chromosome
10
Position
95.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Overgo hybridization and physical mapping 
TG403 was used as an overgo probe on plate 5 [well C9]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CCACGTTGAAAGACAGAGGGTTGA
B sequence
AATGGCTGGTGTACCTTCAACCCT
AB sequence
CCACGTTGAAAGACAGAGGGTTGAAGGTAC
Marker sequence
CCCGCCAAATTGTCACTCCATGGGAATCTCCATATTTAAGGACTCCATTT
GAAAAACACAACCACTAAGACATCACTTTACCTTAGATGATTGCTCTGTA
CATTAAGGTATAGCACCCTATTCTTTAGTCCTAGTTTCCCAACCTTTCAA
CCATAAAGCAAATACCAAATTGTCAAAACTGGCTCTTAGCATAGATAGGA
GGCTCAACTATTCCAGAATAGAACAATCCTGACAAATTCTTATACAGTGA
AGTACATTACAACTCCACGTTGAAAGACAGAGGGTTGAAGGTACACCAGC
CATTTGATAAGGTTTTTCGTCTAGAAATTAGAGTGAATAGAAATGAGAAC
AGTAGCTAGATCACTAAGTACTAATCGTACTTCAGCATAATAAGTTTCTG
TCAAAATAACTCTGTTACGCCACAAAAGAGTCGCATAATCTTCCAGCTGA
AAGTTTATGGAATAGAAAAAATAAGAAGTCAAGACACACTATTTGCCTTG
GTTCCCTTATGCAGCTTTGGAACTTCTCTTTTCTTTTGGGGGATGGAGAA
AGTGAGATGTCAGTGTC
Genomic location of TG403  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22 marker 22
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)