SGN Marker TG47

SGN-M220

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1900
Vector
pUC
Cutting Site
EcoR1/BamH1
Drug Resistance
AMP
Image
Forward sequence
TGCAGTTGAATTCGTCTTCTTAACACTATTCTCTTATGCTGTGCATCAAGACAACCACCCTCATTGGGCGGTCATTGCTTCTTCAGGCAT
GACCCTACAGTTAGTACATTTGGTTTTACCAAATCTTCTTCTAAGGATAAATCTATTTGACTATGGTTCACTCTCTAAATCATAAGCTGA
AACAACATCAACATACCCCGTGTAAATCATAAGCTAAAACAAACTCTAGAATAGCCTTACCTCATCATTCCTAGGACCATAATTATATCT
ATACTTAGTCAAAATCATCATAAAATTTACCTACAAGACCATTTAGATCTCACCTGATTAAGATTTGTTGGTTACTCGTAATCCCTTGAA
CTAAGGTGTAACATCTTAACCCCTCCTTTTGAGTATTTATACCATCATATTTTGAAACTTCTCGTAGGTTCATATGTTTCTTTTGGTACT
TGTTAGTATAGCTTGGAGTGGGACCCAAGGGGCTCCAGTGAGTTCTAGACAAGAAAAACGAGATTTGAACATTGCAGATTTTATGTTTTC
TGGT
Reverse sequence
CTTTGTTTGCTTGCAAGACAGAGATTTATACACGCTAATGCTATCTTTTTGTGTCATTAACAGCTAGTTTGATTTGCTTGGTTAATACAG
TTATGGTAGATAGAGAAGATAGTTTCAAAATAGAAAGAATGATGTAGACAGCATTAATGAATCTTTCTCCTTACAATTGTACCTTTGACA
AGGAATCCACCTTTTATAGGTAGTTTGGTGAGTTTGATGGAAGATTGTGGTTGAATCTGGTTGAGTCATAGACACTACTTGTACATTCTT
TTATGACACTGACTTGATGTTGTAAGAGTGAAATGTATAGACTTATCAACAAATAACAGAGTAGAAATAAAAGTAGGTTGAAGATAGCTT
CTTGTTTGGTTCTAACTTGCTCCTTTGTTGACTGATATGATAACATTGTGTCAATATAAGATGATTCAAAATGTTGCCTGAATTTTTATG
AAATTGATATTCATCGTCCAGTTTAGAGAGTTCT
RFLP sequence matches to unigenesNone
Mapped locations  
Map: Potato meta-QTL consensus map   
Map version
107 (location: 53333)
Chromosome
11
Position
34.68 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 50395)
Chromosome
11
Position
35.80 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 48329)
Chromosome
11
Position
70.20 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Eggplant-COSII   
Map version
63 (location: 42470)
Chromosome
12
Position
60.10 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40055)
Chromosome
11
Position
49.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8641)
Chromosome
12
Position
61.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8640)
Chromosome
11
Position
45.40 cM
Confidence
I(LOD2)
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8639)
Chromosome
11
Position
23.30 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992
Overgo hybridization and physical mapping 
TG47 was used as an overgo probe on plate 1 [well B10]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CATCAAGACAACCACCCTCATTGG
B sequence
AAGAAGCAATGACCGCCCAATGAG
AB sequence
CATCAAGACAACCACCCTCATTGGGCGGTC
Marker sequence
TGCAGTTGAATTCGTCTTCTTAACACTATTCTCTTATGCTGTGCATCAAG
ACAACCACCCTCATTGGGCGGTCATTGCTTCTTCAGGCATGACCCTACAG
TTAGTACATTTGGTTTTACCAAATCTTCTTCTAAGGATAAATCTATTTGA
CTATGGTTCACTCTCTAAATCATAAGCTGAAACAACATCAACATACCCCG
TGTAAATCATAAGCTAAAACAAACTCTAGAATAGCCTTACCTCATCATTC
CTAGGACCATAATTATATCTATACTTAGTCAAAATCATCATAAAATTTAC
CTACAAGACCATTTAGATCTCACCTGATTAAGATTTGTTGGTTACTCGTA
ATCCCTTGAACTAAGGTGTAACATCTTAACCCCTCCTTTTGAGTATTTAT
ACCATCATATTTTGAAACTTCTCGTAGGTTCATATGTTTCTTTTGGTACT
TGTTAGTATAGCTTGGAGTGGGACCCAAGGGGCTCCAGTGAGTTCTAGAC
AAGAAAAACGAGATTTGAACATTGCAGATTTTATGTTTTCTGGT
Genomic location of TG47  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D220 marker 220
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)