SGN Marker solcap_snp_sl_31971

SGN-M22003

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58334)
Chromosome
12
Position
62.74 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TGGTATTGAAACTTTTGCAGAATGGCAAGAATTTATTGTCGAAAAAACAA
  
3' flanking region
GAGGAAAATGCAAATATACGCGAATTCTATCATCTAAACGAGAACTGTAT
SNP nucleotide
AT
SNPdb format
TGGTATTGAAACTTTTGCAGAATGGCAAGAATTTATTGTCGAAAAAACAA[A/T]
GAGGAAAATGCAAATATACGCGAATTCTATCATCTAAACGAGAACTGTAT
  
Genomic location of solcap_snp_sl_31971  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22003 marker 22003
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)