SGN Marker T1698

SGN-M2201
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBG33TH
Arabidopsis best BAC match: AB010693.1
Arabidopsis position: 5.1510000
Arabidopsis identities: 0.743
Best GenBank protein hit: BAB10885.1
Evalue: 5.3e-80
Identities: 0.718
Description: strong similarity to unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39752)
Chromosome
2
Position
36.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1698 was used as an overgo probe on plate 11 [well E8]

Plausible BAC Matches:   P030I18,   P320M09,   P160C24,   P070M02,   P123P19,   P212O09

 Overgo Sequences

A sequence
GTATACGAATGGCTCGTTCCGCTC
B sequence
GCTGACATCTCATCCAGAGCGGAA
AB sequence
GTATACGAATGGCTCGTTCCGCTCTGGATG
Marker sequence
GCACTTTTGTATTTCAACAGCCTTCTTTCAAGCAAAGTATACGAATGGCT
CGTTCCGCTCTGGATGAGATGTCAGCAACAGGTGCTTTTGAGAGAACTGC
TTCAACCTTCCGTAATATAGTCTCAAGGGAACCCGGCTCAGTTTTTCCAG
TCGAATCTGGGAGGTACCACCTCTACATATCATATGCTTGCCCATGGGCA
TCAAGGTGCCTGGCTTACTTGAAGATTAAAGGCCTTGATCAAGCCATTGA
TTTCACATCTGTTAAACCTGTTTGGGAGAGGACGAAGGACAGCGATGAGC
ACACGGGATGGGTTTTTGCTTCATCAAGCACCGAGGAAGCAGGAGCTGAT
CTTGATCCTCTTAATGGAGCCAAAAGCATACGGGAGCTGTATGAGCTTGC
AAGTACAAACTATTCTGGGAAATACACTGTTCCGGTTCTTTGGGATAAGA
AACTGAAGACAATCGTGAACAACGAGAGTGCAGAAATAATACGCATGTTT
AATAGTGAATTTAATGATATAGCTGAGAATGCAGCTTTGGACCTTTATCC
TCCTCATTTGCAATCCCTAATCAATGAAGCAAATGAATGGATATATGATG
GAATAAACAACGGAGTGTAT
Genomic location of T1698  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2201 marker 2201
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)