SGN Marker solcap_snp_sl_32032

SGN-M22012

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72203)
Chromosome
11
Position
69.02 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68398)
Chromosome
11
Position
74.36 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64783)
Chromosome
11
Position
90.53 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58343)
Chromosome
11
Position
50.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AGAGAATGTTACACTCTAATGACTCCAAGTTACACAATGGATGATGATCA
  
3' flanking region
CAATTTGGAACAAGGTTCAACAATCAAAATCATGAACAATTAGCAACAAC
SNP nucleotide
AT
SNPdb format
AGAGAATGTTACACTCTAATGACTCCAAGTTACACAATGGATGATGATCA[A/T]
CAATTTGGAACAAGGTTCAACAATCAAAATCATGAACAATTAGCAACAAC
  
Genomic location of solcap_snp_sl_32032  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22012 marker 22012
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)