SGN Marker solcap_snp_sl_32051

SGN-M22016

Synonyms  
SL1_00sc6004_356369
SL1_00sc6004_356369_solcap_snp_sl_32051
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67096)
Chromosome
11
Position
71.84 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63562)
Chromosome
11
Position
88.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58347)
Chromosome
11
Position
50.52 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ACGGCGGCGATGTCGTGAAGCTGAAGGATTATCGACTCCATTGTTTCCGA
  
3' flanking region
ACCATTTTCTTTGAGCTTTTAGATTGAAGGTGGCTACTGGGTAGAGTTCA
SNP nucleotide
TC
SNPdb format
ACGGCGGCGATGTCGTGAAGCTGAAGGATTATCGACTCCATTGTTTCCGA[T/C]
ACCATTTTCTTTGAGCTTTTAGATTGAAGGTGGCTACTGGGTAGAGTTCA
  
Genomic location of solcap_snp_sl_32051  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22016 marker 22016
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)