SGN Marker solcap_snp_sl_32056

SGN-M22018

Synonyms  
SL1_00sc6004_327317
SL1_00sc6004_327317_solcap_snp_sl_32056
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58349)
Chromosome
11
Position
50.49 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCCGGTAAGTTCCCGTCGGAGTCGGACAATGTAAGTCCTACTTGAATTAT
  
3' flanking region
TTCAGAACGTCGACGTTTGATTTTAACATCTTGTAATGCTCCGATGGTAA
SNP nucleotide
AG
SNPdb format
TCCGGTAAGTTCCCGTCGGAGTCGGACAATGTAAGTCCTACTTGAATTAT[A/G]
TTCAGAACGTCGACGTTTGATTTTAACATCTTGTAATGCTCCGATGGTAA
  
Genomic location of solcap_snp_sl_32056  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22018 marker 22018
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)