SGN Marker solcap_snp_sl_32178

SGN-M22026

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68400)
Chromosome
2
Position
1.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58357)
Chromosome
2
Position
16.58 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GTCCTAACCCTGTTTCGAGTTCAGTTCCCAGTTCATCTGTCTCATCCAAC
  
3' flanking region
TCTTAACCGAAAATGACGTTGAATACACGAGCCGATAGCTGACACACATC
SNP nucleotide
AG
SNPdb format
GTCCTAACCCTGTTTCGAGTTCAGTTCCCAGTTCATCTGTCTCATCCAAC[A/G]
TCTTAACCGAAAATGACGTTGAATACACGAGCCGATAGCTGACACACATC
  
Genomic location of solcap_snp_sl_32178  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22026 marker 22026
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)