Notice: The website will be down for maintenance on Aug 18th (Sunday).

SGN Marker T1700

SGN-M2203
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBG45TH
Arabidopsis best BAC match: AP002063.2
Arabidopsis position: 3.0172000
Arabidopsis identities: 0.706
Best GenBank protein hit: AAG12880.1
Evalue: 1.3e-76
Identities: 0.733
Description: senescence-associated protein-like [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39753)
Chromosome
4
Position
56.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1700 was used as an overgo probe on plate 8 [well C2]

Plausible BAC Matches:   P039C13

 Overgo Sequences

A sequence
GGTGCTTGTTTCCATGTTGCATGG
B sequence
AGTAGAGCCAAAGTGCCCATGCAA
AB sequence
GGTGCTTGTTTCCATGTTGCATGGGCACTT
Marker sequence
GCAAGAACCTTGTGAAGTAGAAAATATGTATAGATTTAGCAACACAGTAA
TAGGTTTCTTGAATCTATTCACACTTTTAGCATCCATTCCGATCATAGGT
GCTGGATTATGGATGGCAAGGAGTAGTACAACATGTGAGAAATTTCTTCA
AACACCACTTTTGTTCATAGGTTTCATAATCCTTATAGTTTCATTGGCTG
GTTTCATTGGTGCTTGTTTCCATGTTGCATGGGCACTTTGGCTCTACTTA
TTTGTCATGTTGTTCCTCATAGGGGCATTAATGGGGCTAACTGTTTTTGG
TTTTGTGGTAACAAGCCAAGGTGGTGGACTTGATGTGCCTGGTAAAGTAT
ATAAAGAGTATCATCTTCAAAATTACTCACCATGGTTGAGAAAGAGGATT
AAGGATCCTCAATATTGGCTCACTGTTAGAGCTTGTATTTTGGGTTCCAA
GACTTGTGCTAATGTTATTACTTGGACTCCCTATGATTATCTTACGAAAG
ATTTGACTCCTATTCAGTCAGGATGTTGCAAGCCACCAACAGCATGCAAC
TATGGATTGACAACAATGAC
Genomic location of T1700  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2203 marker 2203
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)