SGN Marker solcap_snp_sl_32340

SGN-M22037

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68406)
Chromosome
9
Position
15.47 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58368)
Chromosome
9
Position
1.75 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATACTTCCTACATTTTGGGAGCTAAGCAAAAAGTTCCCAAAACTCTCTTT
  
3' flanking region
GTATACGCTGATATTGATGAATGCCCAGAGACAACACAGAACCTTCGATA
SNP nucleotide
TC
SNPdb format
ATACTTCCTACATTTTGGGAGCTAAGCAAAAAGTTCCCAAAACTCTCTTT[T/C]
GTATACGCTGATATTGATGAATGCCCAGAGACAACACAGAACCTTCGATA
  
Genomic location of solcap_snp_sl_32340  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22037 marker 22037
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)