SGN Marker solcap_snp_sl_32346

SGN-M22041

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58372)
Chromosome
9
Position
1.50 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGTCTGGAATGCAGCATTTAGGATAATGTAAATGAAGAAAGCAAGTGAC
  
3' flanking region
AAAATTCTCCCTTCATCCCAAAGTCCCGATTTACGTGACATAGTTTTGAA
SNP nucleotide
AG
SNPdb format
AAGTCTGGAATGCAGCATTTAGGATAATGTAAATGAAGAAAGCAAGTGAC[A/G]
AAAATTCTCCCTTCATCCCAAAGTCCCGATTTACGTGACATAGTTTTGAA
  
Genomic location of solcap_snp_sl_32346  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22041 marker 22041
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)