SGN Marker T1703

SGN-M2206
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07
Tomato EST read: TRZBG63TH
Arabidopsis best BAC match: AC004561.2
Arabidopsis position: 2.1670000
Arabidopsis identities: 0.660
Best GenBank protein hit: AAG16759.1
Evalue: 5e-125
Identities: 1.000
Description: putative glutathione S-transferase T4 [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39754)
Chromosome
6
Position
51.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1703 was used as an overgo probe on plate 14 [well E6]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
CTGTCCTACTACACGACGACAAAC
B sequence
AGAGATTCAACGACGGGTTTGTCG
AB sequence
CTGTCCTACTACACGACGACAAACCCGTCG
Marker sequence
TGGGACAAGTGAAGTTGATAGGGTCATCAGGGAGCTTATTTTGCACTAGA
GTAGAATGGGCTTTGAAGCTCAAGGGAGTTGACTATGAATATATACAAGA
AGATTTATTGAACAAGAGTGAGTTGCTCATCAAGTCCAACCCTGTTCATA
AGAAGATCCCTGTCCTACTACACGACGACAAACCCGTCGTTGAATCTCTG
CTTATTCTTGAATATATTGATGAAACATGGAAAGGATACCCTCTGTTGCC
TCAGGATCCTCATGAACGAGCTACAGCTCGTTTCTGGGCAAAATTTGTTG
ATGACAAGTGTGTCATAGGATCATGGGAAGCTATGGCAATGCAAGATGAA
GGAGAGGCAAAAACAAAAGCTATAGAGTCAATACAAGAATTGTATGCATT
TATCGAGAAGCAGATTGAAGGCAAGAAGTTTTTTGGCGGGGAGCAGATAG
GCTACCTGGATCTAGTTATGGGTTGGAAAACTCTTTGGCTCAGTGCCATG
GAGGAAGTAGGAAATGTGAAGCTACTTGATCCAGAGAAGTTCCCTTCACT
CCATCAATGGGCTGAAAACTTCAAACAGATTCCTATTATAAACGAGTGCA
TGCCACAACAAGAGACCCTAGTCAACTACTTTCAAGTTGGCCTAAACTAC
Genomic location of T1703  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2206 marker 2206
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)