SGN Marker T1704

SGN-M2207
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 1.01.01
Tomato EST read: TRZBG70TH
Arabidopsis best BAC match: AC018907.3
Arabidopsis position: 3.0113000
Arabidopsis identities: 0.718
Best GenBank protein hit: AAC17993.1
Evalue: 2e-104
Identities: 0.989
Description: dehydroquinate dehydratase/shikimate:NADP oxidoreductase [Lycopersicon esculentum]
Comment: chorismate biosynthesis:precursor of Phe and Tyr
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49486)
Chromosome
1
Position
69.09 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47420)
Chromosome
1
Position
41.58 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39755)
Chromosome
1
Position
39.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1704 was used as an overgo probe on plate 10 [well H8]

Plausible BAC Matches:   P155H17,   P047H01,   P305F14,   P033C15

 Overgo Sequences

A sequence
ATAGCCATGGTCATGGGAGAGAAG
B sequence
TCCGAGACATCAAACCCTTCTCTC
AB sequence
ATAGCCATGGTCATGGGAGAGAAGGGTTTG
Marker sequence
GACTTCGATTATCGATGGAGTTGGGAGCTGATTACATTGATGTTGAGCTA
AAGGCTATTGGCGAGTTCAACAATGCCCTACATGGAAATAAATCTGCAAA
ATGCAAACTTATTGTTTCTTCTCACAACTATGAAAGCACACCGTCAGCTG
AGGATCTTGGCAATCTAGTAGCAAGAATACAGGCATCTGGAGCTGACATT
GTGAAATTTGCTACAACTGCACAGGATATCACTGATGTTGCACGTGTTTT
CCAAATTACTGTTCATTCTCAAGTTCCAATAATAGCCATGGTCATGGGAG
AGAAGGGTTTGATGTCTCGGATACTTTGTCCAAAATTTGGTGGATACCTC
ACGTTTGGTACTCTTGAAGTGGGAAAAGTTTCAGCTCCTGGGCAACCAAC
AGTCGAAGATCTTCTGAATTTATACAATTTCAGACAGTTGGGACCAGATA
CCAAAATATTTGGCATTATTGGGAAGCCAGTTAGCCATAGCAAATCACCT
TTATTATATAATGAATCCTTCAGATCAGTTGGGTTTAATGGTGTTTTCAT
GCATTTGCTGGTAGAAGATATTGCAAAC
Genomic location of T1704  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2207 marker 2207
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)