SGN Marker solcap_snp_sl_328

SGN-M22098

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72244)
Chromosome
5
Position
85.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58429)
Chromosome
5
Position
64.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTTCACAATGTACGGAATGATGCTTGTAGCACTCACTCCAAGCTACCC
  
3' flanking region
ATTGCTGCCATCGTCATGACATTCTTCCTCACTTTGTGGAACTTGTTCTC
SNP nucleotide
AG
SNPdb format
TACTTCACAATGTACGGAATGATGCTTGTAGCACTCACTCCAAGCTACCC[A/G]
ATTGCTGCCATCGTCATGACATTCTTCCTCACTTTGTGGAACTTGTTCTC
  
Genomic location of solcap_snp_sl_328  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22098 marker 22098
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)