SGN Marker TG497

SGN-M221

SynonymsNone
Locus associationsNone
RFLP details 
Insert size
1300
Vector
pGEM4Z
Cutting Site
PST1
Drug Resistance
AMP
Image
TG497 image not available
Forward sequence
TGTTTGTGTTCTTGGTGGCGGAGAGTGAAGATGCATTGGTTAAGAGGTTGATTGATAGGAAGACTGAGACTAAAGAGACTTTGCTAGTGA
GAATTGCAACGTCTCGAGAGGAAGTGAGGCATATGGGGGAGTTTGATTATGTGGTAGTGAATAGAGAAGGAGAGTTGGAGAATTCTGTTA
AGTTAATGGAGTCTATTATTGATGCTGAGAAAGCTAAAGTGAGGCAAAGAACAGTGACAATTTAGAGAGTCTGTTTTTCAGTTTTTTGAT
CTGTTTTTGATTAAGTTGAGCTGATACTCTTAATGTTGTCTTGTATTCAATTTATGCAACATTGTTTTTCCTACTTGTGTTAACCGTGTC
GAGCTCTTGGTTGGTTAAAGTAGATGAGATGTTACTTCTTGCCTTTGATCGATGACATAGTTGTTTTGTTATGGTTTAATTTTGATTTCT
AAT
Reverse sequence
TACTCAACTAGCAGCAAACTAGATATTTTATTATGTATCTATTTTCTAAAATTTGTATAATGTTATCTACTTCTACTGGCACCCATGCTA
CAAGAAGCTTAAATGGTGCACTTTATTGAATACAACAAAGATTTCAAGCCATGCTGAGAAGACTACTGAAAGAGAGAGTCTCATACATAC
ACTGAATGATGATATGAATTATCTTTCTTTTCTAACAATTGCATGAAAAGAGCAGTTAAATCTTAAATGAGTTGTTCTAGTTCAGATGAA
TAGACAGGGCAAGAGGATCATCTTCTATCTTTATGCAGAACAGTGATTGATAGGCTTAACAGAATTGGCAACACACAACATACTACTCAA
AATGAACATAAACAGATACATCAAGTTCCAGAGGGAGCACAATGGAACAGAGATGCAAACTGACGACACTATTAACATAGGCAAGAATTG
CCTTTCGGTTCAGACAATATCTCAAACGAGATGG
RFLP sequence matches to unigenes 
Unigenee valueMatch length (bp)Strand
SGN-U151649343 (75.7% of RFLP seq)+
Mapped locations  
Map: Tomato-EXPIMP 2009   
Map version
126 (location: 53561)
Chromosome
11
Position
0.04 cM
Confidence
uncalculated
Protocol
RFLP


Tomato-EXPIMP 2009

Map: Potato meta-QTL consensus map   
Map version
107 (location: 53341)
Chromosome
11
Position
25.04 cM
Confidence
uncalculated
Protocol
unknown

MQTL_1_Late_blight_11 MQTL_1_Maturity_11 MQTL_2_Late_blight_11 MQTL_2_Maturity_11
Potato meta-QTL consensus map

Map: Sun1642 x LA1589   
Map version
85 (location: 43872)
Chromosome
11
Position
3.60 cM
Confidence
uncalculated
Protocol
RFLP


Sun1642 x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43334)
Chromosome
11
Position
3.80 cM
Confidence
uncalculated
Protocol
RFLP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Map: Eggplant-COSII   
Map version
63 (location: 42477)
Chromosome
11
Position
40.60 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-COSII

Map: Tomato-EXPIMP 2008   
Map version
55 (location: 40876)
Chromosome
11
Position
0.00 cM
Confidence
uncalculated
Protocol
CAPS


Tomato-EXPIMP 2008

PCR data   Exp. ID 36583
Forward primer (5'-3')
CGTCTCGAGAGGAAGTGAGG
Accessions and product sizes
Approximate temperature
Unknown
Reverse primer (5'-3')
TACTGGCACCCATGCTACAA
Digested band sizes (using EcoRV)
Solanum pennellii TA56
1000
Solanum lycopersicum TA209
550
Mg+2 concentration
1.5mM
   Enzymes
  

Map: Tomato-EXPEN 2000   
Map version
52 (location: 40064)
Chromosome
11
Position
1.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000

Map: Eggplant-LXM 2002   
Map version
29 (location: 8647)
Chromosome
11
Position
41.00 cM
Confidence
F(LOD3)
Protocol
RFLP


Eggplant-LXM 2002

Map: Tomato-EXPEN 1992   
Map version
28 (location: 8646)
Chromosome
11
Position
9.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 1992

Map: Potato-TXB 1992   
Map version
27 (location: 8645)
Chromosome
11
Position
8.90 cM
Confidence
I(LOD2)
Protocol
RFLP


Potato-TXB 1992

Map: Tomato-EXPIMP 2001   
Map version
26 (location: 8651)
Chromosome
11
Position
0.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPIMP 2001
Other PCR data 
PCR data   Exp. ID 14014
Forward primer (5'-3')
CGGAGAGTGAAGATGCATTG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 300+500
Solanum pennellii LA716: 300+400
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAGTTCCAGAGGGAGCACAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 14014
Forward primer (5'-3')
CGGAGAGTGAAGATGCATTG
Digested band sizes (using TaqI)
Solanum lycopersicum LA925: 300+500
Solanum pennellii LA716: 300+400
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAGTTCCAGAGGGAGCACAA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 14149
Forward primer (5'-3')
CGGAGAGTGAAGATGCATTG
Digested band sizes (using TaqI)
Solanum pimpinellifolium LA1589: 350+500
Solanum lycopersicum LA925: 290+500
Mg+2 concentration
Unknown
Reverse primer (5'-3')
AAGTTCCAGAGGGAGCACAA
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 850
Solanum pimpinellifolium LA1589: 850
Approximate temperature
55°C
  
PCR data   Exp. ID 135
Forward primer (5'-3')
Unknown
Digested band sizes (using TaqI)
Solanum pennellii LA716: 300+400
Solanum lycopersicum LA925: 300+500
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
TG497 was used as an overgo probe on plate 1 [well A11]

Plausible BAC Matches:   P218C09

 Overgo Sequences

A sequence
GAATTGCAACGTCTCGAGAGGAAG
B sequence
TCCCCCATATGCCTCACTTCCTCT
AB sequence
GAATTGCAACGTCTCGAGAGGAAGTGAGGC
Marker sequence
TGTTTGTGTTCTTGGTGGCGGAGAGTGAAGATGCATTGGTTAAGAGGTTG
ATTGATAGGAAGACTGAGACTAAAGAGACTTTGCTAGTGAGAATTGCAAC
GTCTCGAGAGGAAGTGAGGCATATGGGGGAGTTTGATTATGTGGTAGTGA
ATAGAGAAGGAGAGTTGGAGAATTCTGTTAAGTTAATGGAGTCTATTATT
GATGCTGAGAAAGCTAAAGTGAGGCAAAGAACAGTGACAATTTAGAGAGT
CTGTTTTTCAGTTTTTTGATCTGTTTTTGATTAAGTTGAGCTGATACTCT
TAATGTTGTCTTGTATTCAATTTATGCAACATTGTTTTTCCTACTTGTGT
TAACCGTGTCGAGCTCTTGGTTGGTTAAAGTAGATGAGATGTTACTTCTT
GCCTTTGATCGATGACATAGTTGTTTTGTTATGGTTTAATTTTGATTTCT
AAT
Genomic location of TG497  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D221 marker 221
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)