SGN Marker solcap_snp_sl_330

SGN-M22112

Synonyms  
CL016163-0135
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72249)
Chromosome
5
Position
85.57 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68435)
Chromosome
5
Position
89.87 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64815)
Chromosome
5
Position
143.81 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58443)
Chromosome
5
Position
64.16 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TCAGATCTTGTACACCATGTGTGGAGAGTTTGGAAAATCAGGAAATTGGT
  
3' flanking region
AGGTTGTGGAGGTATTTGACGAATCATCTTGGAAGATGGCTACAATTGTG
SNP nucleotide
CG
SNPdb format
TCAGATCTTGTACACCATGTGTGGAGAGTTTGGAAAATCAGGAAATTGGT[C/G]
AGGTTGTGGAGGTATTTGACGAATCATCTTGGAAGATGGCTACAATTGTG
  
Genomic location of solcap_snp_sl_330  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22112 marker 22112
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)