SGN Marker T1710

SGN-M2213
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBH45TH
Arabidopsis best BAC match: AC005287.4
Arabidopsis position: 1.0980000
Arabidopsis identities: 1.000
Best GenBank protein hit: BAA99598.1
Evalue: 2.2e-37
Identities: 0.835
Description: similar to unknown protein (ref|NP_004698.1) [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39757)
Chromosome
12
Position
64.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1710 was used as an overgo probe on plate 1 [well H5]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GGTTGTTTGCGCTACAACGCTTCA
B sequence
GGAGGCTTTGAAGCTTTGAAGCGT
AB sequence
GGTTGTTTGCGCTACAACGCTTCAAAGCTT
Marker sequence
GAAAAGAATCAGCAAATTCTTCATAGCTATGGCTGCCGATTCTCGAAAAG
TGATTGTTCATTTAAGAGCCACTGGCGATGCTCCGATTCTTAAACAAGCG
AAATTCAAGATTGCAGGTACTGACAAATTCATCAAAGTAATAGATTTTTT
GCGCCGTCAACTCCATAGGGAGACATTGTTTGTGTATGTCAACAGCGCCT
TCTCACCAAATCCAGATGAGTTGGTAATTGATCTATACAATAACTTTGGT
TTTGATGGTAAGTTGGTGGTCAATTATGCATGCTCCATGGCGTGGGGCTG
AGAACTCCTGGTTGTTTGCGCTACAACGCTTCAAAGCTTCAAAGCCTCCT
CCATACATGAGTAAATAGATAGTATGTAAGATAGAAACCCAACATCAATG
ATTAGTCAGATTGTTATTCTGTAGATTGTTCAGTATATAACTACTCGTAT
GATTTCTATATCGATGCTTTGTGCTTCAGTAGTCTCCTTATGTACTATTC
ACCAACTCTTCAAAGTTCAGACTTGGATATCTGTTATATTCGTATGAGAA
GTTGTGAGTTCCTTTCAACTCTCACAATTGCCACCCTTTA
Genomic location of T1710  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2213 marker 2213
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)