SGN Marker solcap_snp_sl_33469

SGN-M22153

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72265)
Chromosome
2
Position
21.22 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68445)
Chromosome
2
Position
32.26 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64824)
Chromosome
2
Position
46.45 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58484)
Chromosome
2
Position
33.37 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TTACTTTGGTAACCTTCAGAAGGGGGTTTTACCTGAAACCCTGGGAGGAC
  
3' flanking region
TCCCACGGGACAGCAAGCTACAACATTGCTTGAAGTTATGACCATTAGAG
SNP nucleotide
AG
SNPdb format
TTACTTTGGTAACCTTCAGAAGGGGGTTTTACCTGAAACCCTGGGAGGAC[A/G]
TCCCACGGGACAGCAAGCTACAACATTGCTTGAAGTTATGACCATTAGAG
  
Genomic location of solcap_snp_sl_33469  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22153 marker 22153
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)