SGN Marker solcap_snp_sl_33547

SGN-M22160

Synonyms  
SGN-U586107_snp378
SGN-U586107_snp378_solcap_snp_sl_33547
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70481)
Chromosome
2
Position
22.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67009)
Chromosome
2
Position
34.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63483)
Chromosome
2
Position
48.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58491)
Chromosome
2
Position
33.82 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAAAGATACTATTTTTACTGTGAAATTGAAGTTTAGCTGATGGTAGATA
  
3' flanking region
GGTGGAGTTATTAGTTTCTGCTCAAGGGTTGATTTGGTTGTAACTGAAAT
SNP nucleotide
CG
SNPdb format
AAAAAGATACTATTTTTACTGTGAAATTGAAGTTTAGCTGATGGTAGATA[C/G]
GGTGGAGTTATTAGTTTCTGCTCAAGGGTTGATTTGGTTGTAACTGAAAT
  
Genomic location of solcap_snp_sl_33547  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22160 marker 22160
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)