SGN Marker solcap_snp_sl_33558

SGN-M22162

Synonyms  
CL009129-0540
SL20141_109_CL009129-0540_solcap_snp_sl_33558
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 70643)
Chromosome
2
Position
22.03 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 67116)
Chromosome
2
Position
34.16 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 63582)
Chromosome
2
Position
48.59 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58493)
Chromosome
2
Position
33.84 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CACCTGGCTACGGAATTTCTTTAGTTGCAGAGACTACATCTGGTTGTGTC
  
3' flanking region
TATCTGTTGATACTGCAGTTTCTTATTCAAGAGGAGAAGATGATGCTGAC
SNP nucleotide
AG
SNPdb format
CACCTGGCTACGGAATTTCTTTAGTTGCAGAGACTACATCTGGTTGTGTC[A/G]
TATCTGTTGATACTGCAGTTTCTTATTCAAGAGGAGAAGATGATGCTGAC
  

Map: Yellow Stuffer x LA1589   
Map version
83 (location: 43575)
Chromosome
2
Position
26.00 cM
Confidence
uncalculated
Protocol
SNP


Yellow Stuffer x LA1589

Map: Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589   
Map version
79 (location: 43229)
Chromosome
2
Position
38.00 cM
Confidence
uncalculated
Protocol
SNP


Integrated map: Yellow Stuffer X LA1589 and Sun1642 X LA1589

Assay data  
5' flanking region
TTGAATAAGAAACTGCAGTATCAACAGATA
ASPE primers (5'-3')
AGACTACATCTGGTTGTGTCG
AGACTACATCTGGTTGTGTCA
3' flanking region
GACACAACCAGATGTAGTCTCTGCAACTAA
SNP nucleotide
CT
SNPdb format
TTGAATAAGAAACTGCAGTATCAACAGATA[C/T]
GACACAACCAGATGTAGTCTCTGCAACTAA
  
Genomic location of solcap_snp_sl_33558  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22162 marker 22162
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)