SGN Marker solcap_snp_sl_33624

SGN-M22167

Synonyms  
CL017581-0470
CL017581-0470_solcap_snp_sl_33624
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58498)
Chromosome
2
Position
34.29 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
TACTCACAGACTTTCAGAAGCTCTAGTGCAGTGGCAGCTGGTGGCTTCTC
  
3' flanking region
GAAGCCAGGCGATTTGGACTTTTTGAGATAATCTTTCTCTTCCACTCCTC
SNP nucleotide
AG
SNPdb format
TACTCACAGACTTTCAGAAGCTCTAGTGCAGTGGCAGCTGGTGGCTTCTC[A/G]
GAAGCCAGGCGATTTGGACTTTTTGAGATAATCTTTCTCTTCCACTCCTC
  
Genomic location of solcap_snp_sl_33624  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22167 marker 22167
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)