SGN Marker solcap_snp_sl_33636

SGN-M22169

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72271)
Chromosome
2
Position
24.78 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68449)
Chromosome
2
Position
37.00 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58500)
Chromosome
2
Position
34.39 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATTGACCTTTCATCATTTAACAAAGCACAAGGAGGTCCATAAAATGACAT
  
3' flanking region
GTTGCAGCAGTAAACAGACTAAAAAAGGCGCGAGAAACGCCTAATTTACC
SNP nucleotide
AG
SNPdb format
ATTGACCTTTCATCATTTAACAAAGCACAAGGAGGTCCATAAAATGACAT[A/G]
GTTGCAGCAGTAAACAGACTAAAAAAGGCGCGAGAAACGCCTAATTTACC
  
Genomic location of solcap_snp_sl_33636  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22169 marker 22169
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)