SGN Marker T1719

SGN-M2221
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 11.07.03
Tomato EST read: TRZBI06TH
Arabidopsis best BAC match: AC000098.1
Arabidopsis position: 1.0130000
Arabidopsis identities: 0.723
Best GenBank protein hit: AAA65636.1
Evalue: 2.0e-76
Identities: 0.951
Description: peroxidase [Lycopersicon esculentum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39759)
Chromosome
4
Position
63.00 cM
Confidence
I
Protocol
RFLP
Subscript
A


Tomato-EXPEN 2000

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39760)
Chromosome
7
Position
39.00 cM
Confidence
I
Protocol
RFLP
Subscript
B


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 14106
Forward primer (5'-3')
CATGCCTTTTTCTTGGGATG
 
 
Mg+2 concentration
Unknown
Reverse primer (5'-3')
TGGAACCCCTTTAACTGTGC
Enzymes
  
Accessions and product sizes
Solanum pimpinellifolium LA1589: 500
Solanum lycopersicum LA925: 500
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1719 was used as an overgo probe on plate 7 [well G2]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P004E13,   P301P24,   P119K08,   P095C07,   P198F12,   P030M04

 Overgo Sequences

A sequence
TCAGTTGCAGCTCAACTTCTATGC
B sequence
TTGCGGACAGCTCTTTGCATAGAA
AB sequence
TCAGTTGCAGCTCAACTTCTATGCAAAGAG
Marker sequence
TATCTCTTTCAAAAGTTGCAAAAATAAGTAATAAGTAATATAAATGGCTA
AATTTGGCGATTTGGGTAATCTTCTAGTGTTGTGTATACTACTAGGAATA
GTTGGTTCTAGCTATGGTCAGTTGCAGCTCAACTTCTATGCAAAGAGCTG
TCCGCAAGCAGAAAAGATAATTCAAGATTATGTGTATAAGCAAATCCCAA
AGGCTCCGTCTCTTGCACCTGCGTTGCTCAGAATGCATTTCCACGATTGC
TTTGTCAGGGGTTGTGATGGTTCTGTACTCCTGAATTTCACTTCGAGCAC
TAAAAACCAGACTGAAAAAGTGGCTGTTCCTAATCAAACGCTGAGAGGCT
TCTCATTTATCGATGGTGTGAAGAAAGCATTGGAAGCTGAATGCCCTGGA
GTTGTGTCATGTGCGGATATTGTTGCCTTGGTTGCTAGAGACTCTGTTGT
GGTCACAGGAGGCCCTTACTGGAAAGTTCCAACTGGTAGAAGAGATGGAA
GAATATCAAACGCCTCGGAAGCCTTGGCAAACATCC
Genomic location of T1719  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2221 marker 2221
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)