SGN Marker T1720

SGN-M2222
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 7.01
Tomato EST read: TRZBI10TH
Arabidopsis best BAC match: AL132962.1
Arabidopsis position: 3.2500000
Arabidopsis identities: 0.895
Best GenBank protein hit: CAB54830.1
Evalue: 8.0e-79
Identities: 0.848
Description: putative beta-subunit of K+ channels [Solanum tuberosum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39761)
Chromosome
10
Position
32.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1720 was used as an overgo probe on plate 16 [well F2]

Plausible BAC Matches:   P140P23,   P273K06,   P189F19,   P310A03,   P046B18,   P117P21,   P309G23,   P314N19,   P006M18,   P214C05,   P313H15,   P240C22,   P313L03,   P065C04,   P331B05,   P249J09,   P201C12,   P105E23

 Non-Plausible BAC matches

P245I04,   P271H07,   P252I09,   P267F23,   P172K16,   P266F23,   P027J04,   P072B06,   P022G10

 Overgo Sequences

A sequence
AACATGGCTAGGGAGTTGGCATTG
B sequence
CCATAAGGCCTTCCTTCAATGCCA
AB sequence
AACATGGCTAGGGAGTTGGCATTGAAGGAA
Marker sequence
GGAACTATTAAGAAAGCTTACGATCTTTTGGAATCTACACCTAATGCTTA
TATGCTTCAACAATTCTCCAATCCTGCCAATACTCAAGTTCATTTTGAGA
CTACTGGCCCTGAAATCTGGGAAGATACTCAAGGTAATGTTGACATCTTT
GTCATGGGAATAGGAAGTGGAGGCACAGTCTCTGGTGTTGGACAATATCT
GAAATCGAAAAATCCTAATGTCAAGATATATGGAATCGAGCCAGCTGAAA
GCAATGTATTGAATGGTGGAAAACCAGGTCCTCATGAAATAACTGGCAAT
GGGGTTGGATTCAAGCCGGATATCCTTGACATGGATGTAATGGAAGAAGT
TCTGATGGTTTCAAGTGAAGAATCGGTAAACATGGCTAGGGAGTTGGCAT
TGAAGGAAGGCCTTATGGTTGGTATATCATCAGGAGCAAATACTGTAGCC
GCACTTAGACTCGCCAACAGACCAGAAAATAAAGGAAAACTCATAGTGAC
AATTCATCCAAGTTTTGGAGAGAGGTACTTGTCATCTGTTCTGTATGAAG
ATCTCAGGAAAGAGGCACAAAACATGCAACCTGTATCAGTTGATTAGTGT
TCAATTATTATAGTGATAGTACTAGTGAAACTAGTACAAG
Genomic location of T1720  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2222 marker 2222
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)