SGN Marker T1721

SGN-M2223
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBI14TH
Arabidopsis best BAC match: AF077407.1
Arabidopsis position: 5.0590000
Arabidopsis identities: 0.852
Best GenBank protein hit: AAC26247.2
Evalue: 5.0e-24
Identities: 0.830
Description: Arabidopsis thaliana CLC-d chloride channel protein
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39762)
Chromosome
9
Position
61.50 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1721 was used as an overgo probe on plate 15 [well G1]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
GCCAACTAGGACTGAGGCACTTAC
B sequence
GGACGTGGAACAACAAGTAAGTGC
AB sequence
GCCAACTAGGACTGAGGCACTTACTTGTTG
Marker sequence
AAACCCATCTCCGTATGTAGTCCCAGAAGACATGTCATTAACAAAGGTAT
ATAATCTTTTTCGCCAACTAGGACTGAGGCACTTACTTGTTGTTCCACGT
CCTGCTCGTGTTATTGGCATGATCACTCGAAAAGATCTGATACTTGAGGA
TAATGATGATCCAACGGCTGTAGAACTCCAATCAACTAGTAGGTACACAA
TCTAACCATAGAGTGATCAAGAAGAAAGGAGATGCCCAACAGCCGCTTCT
TGATGGGCTTCTTTAAAG
Genomic location of T1721  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2223 marker 2223
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)