SGN Marker T1726

SGN-M2228
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBI70TH
Arabidopsis best BAC match: AC006955.5
Arabidopsis position: 2.0230000
Arabidopsis identities: 0.750
Best GenBank protein hit: AAA79366.1
Evalue: 1.2e-54
Identities: 0.688
Description: unknown [Gossypium hirsutum]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39763)
Chromosome
7
Position
40.00 cM
Confidence
I
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1726 was used as an overgo probe on plate 10 [well D4]

Plausible BAC Matches:   None

 Overgo Sequences

A sequence
TAGTGGCGAAAGGCAAAGCGATTG
B sequence
GCCATGATTGGAGATCCAATCGCT
AB sequence
TAGTGGCGAAAGGCAAAGCGATTGGATCTC
Marker sequence
GCTCAAGCCTTTCCTCTCTCTCTCAGCTTCTCTGTTTCAAGGGGTCAGTG
AGTGTGAAAATGGGCTACTCCAGGGTTCTTATTGTTAGTAGTCTACTTCT
AGTGTTTCAATTATCAACTGTAGTGGCGAAAGGCAAAGCGATTGGATCTC
CAATCATGGCACCAGCACCAGCACCAGGTCCTGAATACACAAACCTAACG
GACTTACTCTCCGTTGCAGGGCCTTTTCATACATTCCTTAACTACCTTGT
ATCGACTAAAGTCATCGAGACTTTCCAAGCCCAAGCTAACAATACAGAAG
AAGGGATCACACTTTTTGTTCCTAAAGACTCAGCCTTTACCTCACTGAAA
AAGCCCTCACTTTCCAATCTTACCTCAGAACAACTTAAGTCCCTTTGCCT
TTTCCACGCATTGCCACATTACTATAGTCTAGCTGATTTCAAGAACCTTA
GTGATGTTAGCCCTATTAATACCTTGGCTGGAGGGAACTTATACTCTTTG
AACTTCACCGATGACTCTGGGACCGTTCATCTTAACTCAGGATGGTCTAG
GACTAAAGTTAGCAGCGCTGTTCGCACCACTTATCCAGTTGCTGTTTATC
Genomic location of T1726  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2228 marker 2228
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)