SGN Marker solcap_snp_sl_3430

SGN-M22295

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64858)
Chromosome
9
Position
79.63 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58626)
Chromosome
9
Position
63.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GATTTATTCACAGATAACGAAGAGGATGATATGGAAAATGCTGATATCAG
  
3' flanking region
ATCAAGGGAAGGAGGAGAGAAGACGATGGCATCTTTTTACGACTCAGGAT
SNP nucleotide
TC
SNPdb format
GATTTATTCACAGATAACGAAGAGGATGATATGGAAAATGCTGATATCAG[T/C]
ATCAAGGGAAGGAGGAGAGAAGACGATGGCATCTTTTTACGACTCAGGAT
  
Genomic location of solcap_snp_sl_3430  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22295 marker 22295
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)