SGN Marker solcap_snp_sl_3435

SGN-M22307

SynonymsNone
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58638)
Chromosome
9
Position
63.19 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAAACAGAGCAGGCTGAGTTGAAATCACAAAAATCTTTCTTGGCAAAAGG
  
3' flanking region
ATTAAGTCTATAGACTCTGAAAACGATGGAACTGATACATCACTTAATTT
SNP nucleotide
TC
SNPdb format
AAAACAGAGCAGGCTGAGTTGAAATCACAAAAATCTTTCTTGGCAAAAGG[T/C]
ATTAAGTCTATAGACTCTGAAAACGATGGAACTGATACATCACTTAATTT
  
Genomic location of solcap_snp_sl_3435  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22307 marker 22307
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)