SGN Marker solcap_snp_sl_34484

SGN-M22327

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68492)
Chromosome
1
Position
55.21 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64869)
Chromosome
1
Position
79.58 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58658)
Chromosome
1
Position
76.35 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
AAGGGTCGAAAGTTGAAGCCTTTACTAAGGGCGAGTCCAGTACGGGCAAG
  
3' flanking region
CCCAAATCCACCCCAAGACTAAAACCTCCTCTCCATGTTGAATCGAGCTT
SNP nucleotide
AC
SNPdb format
AAGGGTCGAAAGTTGAAGCCTTTACTAAGGGCGAGTCCAGTACGGGCAAG[A/C]
CCCAAATCCACCCCAAGACTAAAACCTCCTCTCCATGTTGAATCGAGCTT
  
Genomic location of solcap_snp_sl_34484  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22327 marker 22327
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)