SGN Marker T1736

SGN-M2233
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBJ50TH
Arabidopsis best BAC match: AL035602.1
Arabidopsis position: 4.1410000
Arabidopsis identities: 0.643
Best GenBank protein hit: CAB81404.1
Evalue: 4.5e-50
Identities: 0.545
Description: hypothetical protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39764)
Chromosome
12
Position
52.00 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35611
Forward primer (5'-3')
ATTCTCGATCAACGGACCAC
 
 
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
ACACTGAGCAATGCGAATCA
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1050
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
PCR data   Exp. ID 150
Forward primer (5'-3')
Unknown
Digested band sizes (using unknown)
Solanum pennellii LA716: 1050
Solanum lycopersicum LA925: 1200
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 1050
Solanum lycopersicum LA925: 1200
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1736 was used as an overgo probe on plate 5 [well A5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

P310P17,   P198C20,   P109O06,   P293O18,   P291G12,   P138F21,   P331B14,   P120K04,   P060L11,   P039K05,   P202P07,   P203N23

 Overgo Sequences

A sequence
CAGCTAACCCGTTATCTCTGAGTG
B sequence
AATACGGGTTCGGGTACACTCAGA
AB sequence
CAGCTAACCCGTTATCTCTGAGTGTACCCG
Marker sequence
GGTTCTCAGCTAACCCGTTATCTCTGAGTGTACCCGAACCCGTATTCGAA
TCCTGGCTCCGAGATACTGGCTACCTCGAAATTCTCGATCAACGGACCAC
CGATCTCCACCGCCACTCCTCCACCACCACCGTGGCGGCGACGACTGCTT
CCTCCGACGCTGCTGTTACTAATTCTGCTGCAGCCGCGGTGTCAATTTCA
AATGGAGTCTTCGTTCTAATATTTTCACGTATTGGAACCTTATTATCGCT
TTTAACGCTTAATCCGTTTGCAAAACTCACATCTGATGACTTTTCCGGTG
ATACCCCGTCGTGGACCCTCCAATTCGTCGGGTCATTCGATTCCTACTCA
TTTCCTTCGTCGCCGTCTCAGGCTCGGCTTAGAGTACACGAGAATGTGAA
ACGCTATGCTCGGAATTATGCCTCCCTCTTTGTCCTCTTCTTTGCTTGCT
CTCTGTACCAAAAGCTGTTTGCCCTTGTTGGGTTGATATCATGTTTGGCA
CTTTGGGATGTATTAAAGTTATGTGGAGATCGCTGGGGATTAGAGCACCG
NCCAGTTATCAAACAAAGCTTGATTCGCATTGCTCAGTGTGCTACTGCAG
GTATTCTATTCTGTACCAACGTTCAAAT
Genomic location of T1736  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2233 marker 2233
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)