SGN Marker solcap_snp_sl_34582

SGN-M22337

Synonyms  
Cd2_2182
Cd2_2182_solcap_snp_sl_34582
Locus associationsNone
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58668)
Chromosome
1
Position
76.99 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
CTGCTATTTGGAAACGTTGGTGCACCAGAAGTTTCACGGATGGTATCAAT
  
3' flanking region
GATACATCAACGACAGCCCAGACACCTTCAGCATGTTGTTTGCAGAAACG
SNP nucleotide
CG
SNPdb format
CTGCTATTTGGAAACGTTGGTGCACCAGAAGTTTCACGGATGGTATCAAT[C/G]
GATACATCAACGACAGCCCAGACACCTTCAGCATGTTGTTTGCAGAAACG
  
Genomic location of solcap_snp_sl_34582  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22337 marker 22337
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)