SGN Marker T1737

SGN-M2234
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBJ51TH
Arabidopsis best BAC match: AL049914.1
Arabidopsis position: 4.1580000
Arabidopsis identities: 0.686
Best GenBank protein hit: CAB79831.1
Evalue: 6.8e-29
Identities: 0.686
Description: putative protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 49488)
Chromosome
8
Position
0.76 MB
Confidence
uncalculated
Protocol
unknown


Tomato - Kazusa and SolCAP markers mapped to genome

Map: Kazusa F2-2000 genetic map   
Map version
103 (location: 47422)
Chromosome
8
Position
2.84 cM
Confidence
uncalculated
Protocol
unknown


Kazusa F2-2000 genetic map

Map: Tomato-EXPEN 2000   
Map version
52 (location: 39765)
Chromosome
8
Position
2.00 cM
Confidence
CF(LOD3)
Protocol
RFLP


Tomato-EXPEN 2000
Overgo hybridization and physical mapping 
T1737 was used as an overgo probe on plate 1 [well E4]

Plausible BAC Matches:   P322F18,   P148N01,   P317P02,   P151P10,   P144K24

 Non-Plausible BAC matches

P330E20,   P019H22,   P079M06

 Overgo Sequences

A sequence
TCACGAGCGTTATCAGCCAACATC
B sequence
TCTGGTTGGTGGCTTTGATGTTGG
AB sequence
TCACGAGCGTTATCAGCCAACATCAAAGCC
Marker sequence
ACGGAAAACAATCCATATATTTTATTATACTTAGAAAGGCAGGAAAACAT
GTTTTTTTTACAGTTTGTGCTGAAAGTTCATTTTGCAACATCCCATTTAA
CAAAGAGAGAGTAGAAAGGCTTAAGCACTGGTCTTGATAATTTCATCATC
TGCATAACTTGCTTTCGGCTCGCCCTTGATATCCGTTTCTTGGAAATAAT
CCTCACGAGCGTTATCAGCCAACATCAAAGCCACCAACCAGAAGAGCGCG
GAATCAAGAGACAAGAAGGCACCTCCACCTAAAAGACCGGTCTTGGCAGT
TGGGCAATCGGTCTGCAAGTTGTGATGAATGTTGCGTGTGATATGAAGTT
GCTCGGTGATTGTAGGCCACAACAACAATGTTGCTGCTAAACCAGTTGTG
CCCAATGCAATATTTAAGAACACGAGGAA
Genomic location of T1737  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2234 marker 2234
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)