SGN Marker T1738

SGN-M2235
COS markers are Conserved Ortholog Set - orthologs between tomato and arabidopsis

SynonymsNone
Locus associationsNone
COS information 
MIPS Category: 99
Tomato EST read: TRZBJ56TH
Arabidopsis best BAC match: AB025629.1
Arabidopsis position: 3.0600000
Arabidopsis identities: 0.698
Best GenBank protein hit: BAB02479.1
Evalue: 1.2e-45
Identities: 0.477
Description: unknown protein [Arabidopsis thaliana]
Comment:
More information about COS markers can be found on the COS markers page.
Mapped locations  
Map: Tomato-EXPEN 2000   
Map version
52 (location: 39766)
Chromosome
7
Position
72.50 cM
Confidence
I
Protocol
CAPS


Tomato-EXPEN 2000
Other PCR data 
PCR data   Exp. ID 35612
Forward primer (5'-3')
GGTTGGTATGGAAGGTCTGC
Digested band sizes (using DpnII)
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 200+600
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
CGGCTTCCACCAGTGATATT
Enzymes
  
Accessions and product sizes
Solanum lycopersicum LA925: 800
Solanum pennellii LA716: 800
Approximate temperature
55°C
  
PCR data   Exp. ID 95
Forward primer (5'-3')
Unknown
Digested band sizes (using DpnII)
Solanum lycopersicum LA925: 200+600
Solanum pennellii LA716: 800
Mg+2 concentration
1.5mM
Reverse primer (5'-3')
Unknown
Enzymes
  
Accessions and product sizes
Solanum pennellii LA716: 800
Solanum lycopersicum LA925: 800
Approximate temperature
55°C
  
Overgo hybridization and physical mapping 
T1738 was used as an overgo probe on plate 7 [well H5]

Plausible BAC Matches:   None

 Non-Plausible BAC matches

 Overgo Sequences

A sequence
CAGCAGAGACAATAGCAGCAGTAG
B sequence
AGGACTTAGGCCCATACTACTGCT
AB sequence
CAGCAGAGACAATAGCAGCAGTAGTATGGG
Marker sequence
GGTTGGTATGGAAGGTCTGCAGATCTTAAAACCACGTTCTCCACATAGTA
TCAGGCAAGATAGTCCTGAAGGACCTCTTAAAGAGACTGCTGAGAGATTT
GGTGGTATGAACATCGAAGTAGACATAGTGAATTGCGAAGACGATATTGA
TGATGGATTGGGAAAGTGGATTGTCGAAAATTTGAAATTTTCTGTCAAAC
AGCCGATCGAGGCAGTAGTGACTAAGGCTGAGCTCAAGTATCTTGCTTTC
TTGTGCAAGTCTGAGGTTGACTCCATGGGTCGGATTGCCGCTGGAATTCT
GCGGGTACTTAAGTTAGAAAATAAAATTGGCGCAGGAGCAATCAGTCAAC
TAAGTAACTTAGGAAGTGAAAGCTTTGATAGAATATTTACTCCTGAAAAA
CTCAGCAGAGACAATAGCAGCAGTAGTATGGGCCTAAGTCCTTCGTCAAA
TATCACTGGTGGAAGCCGAAACCCATATCTTGAGTCAACAGTAGCTTCTC
TTGAGGACATGATCAAGGAATCACAGACCAAATGTTCTTCTTTAAGTGTT
GAACTAGCTAATTCAACATCTTCTCTCGATGACGTTAAAGAGCTGAGTCA
GAAACTGGAGAACATGCAGAAATTATTGATGCAATTGCGAACTCAAG
Genomic location of T1738  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D2235 marker 2235
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)