SGN Marker solcap_snp_sl_34714

SGN-M22356

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72344)
Chromosome
8
Position
47.28 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68504)
Chromosome
8
Position
37.08 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: TraitGenetics EXPEN2000   
Map version
145 (location: 64880)
Chromosome
8
Position
57.07 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2000

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58687)
Chromosome
8
Position
56.36 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
ATGAAGAAGCCAGCACTTGCAACACATTTTACTCTGGCACTCCCTGGAAG
  
3' flanking region
AGGCTTTTGAACTTGTCACAGTTCAAGATTGTTGCCAACCCTCCGGCTGA
SNP nucleotide
AG
SNPdb format
ATGAAGAAGCCAGCACTTGCAACACATTTTACTCTGGCACTCCCTGGAAG[A/G]
AGGCTTTTGAACTTGTCACAGTTCAAGATTGTTGCCAACCCTCCGGCTGA
  
Genomic location of solcap_snp_sl_34714  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22356 marker 22356
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)