SGN Marker solcap_snp_sl_34811

SGN-M22370

SynonymsNone
Locus associationsNone
Mapped locations  
Map: TraitGenetics EXPIMP2012   
Map version
149 (location: 72350)
Chromosome
8
Position
66.50 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPIMP2012

Map: TraitGenetics EXPEN2012   
Map version
147 (location: 68510)
Chromosome
8
Position
63.30 cM
Confidence
uncalculated
Protocol
unknown


TraitGenetics EXPEN2012

Map: Tomato - Kazusa and SolCAP markers mapped to genome   
Map version
105 (location: 58701)
Chromosome
8
Position
60.68 MB
Confidence
uncalculated
Protocol
SNP


Tomato - Kazusa and SolCAP markers mapped to genome

Assay data  
5' flanking region
GAAAGAGGAAAATTCCAAGAAGAGTAGCAATAATCAAATTAAACTCCATT
  
3' flanking region
TGTTTAATTAATTTAATATATTTAATGATCTTAAGATTGATGGAAAAGTA
SNP nucleotide
TG
SNPdb format
GAAAGAGGAAAATTCCAAGAAGAGTAGCAATAATCAAATTAAACTCCATT[T/G]
TGTTTAATTAATTTAATATATTTAATGATCTTAAGATTGATGGAAAAGTA
  
Genomic location of solcap_snp_sl_34811  
%2Fsearch%2Fmarkers%2Fmarkerinfo.pl%3Fmarker_id%3D22370 marker 22370
User comments 
Please wait, checking for comments. (If comments do not show up, access them here)